Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00009470
Genome
Geobacter sulfurreducens - NC_002939.5
TF
HgtR [UniProtKB:Q747A3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCCCTGTATACTGTATACAATA - [3704540, 3704561] 19939938 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Primer Extension assay (ECO:0005657) - 456

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... GSU3370 GSU3371 cls-2
Gene Locus tag Description
GSU3370 GSU3370 GntR family transcriptional regulator
GSU3371 GSU3371 TIM barrel protein, AP endonuclease family 2/xylose isomerase-like family
cls-2 GSU3372 cardiolipin synthase