Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00009480
Genome
Geobacter sulfurreducens - NC_002939.5
TF
HgtR [UniProtKB:Q747A3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATTGTATACAGTATCCATTT + [1822570, 1822591] 19939938 Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Primer Extension assay (ECO:0005657) - 457

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... acnB hisS GSU1658 GSU1657 GSU1661 GSU1662
Gene Locus tag Description
acnB GSU1660 bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase
hisS GSU1659 histidyl-tRNA ligase
GSU1658 GSU1658 response receiver-modulated diguanylate cyclase
GSU1657 GSU1657 ComEC-like competence protein
GSU1661 GSU1661 hypothetical protein
GSU1662 GSU1662 hypothetical protein