Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000094a0
Genome
Geobacter sulfurreducens - NC_002939.5
TF
HgtR [UniProtKB:Q747A3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAGTTGTATACAGTATGTGCTA + [1609869, 1609890] 19939938 Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Primer Extension assay (ECO:0005657) - 457

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... korD korA korB korC mdh icd
Gene Locus tag Description
korD GSU1467 2-oxoglutarate:ferredoxin oxidoreductase, ferredoxin subunit
korA GSU1468 2-oxoglutarate ferredoxin oxidoreductase subunit alpha
korB GSU1469 2-oxoglutarate ferredoxin oxidoreductase subunit beta
korC GSU1470 2-oxoglutarate:ferredoxin oxidoreductase subunit gamma
mdh GSU1466 malate dehydrogenase
icd GSU1465 isocitrate dehydrogenase