Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000094e0
Genome
Geobacter sulfurreducens - NC_002939.5
TF
HgtR [UniProtKB:Q747A3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGATTGTATACAGTATGCGATC + [417289, 417310] 19939938 Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Primer Extension assay (ECO:0005657) - 457

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... GSU0385 GSU0384 GSU0383 GSU0382 GSU0381 lipA lplA gcvP2 gcvP1 gcvH-1 gcvT hypA GSU0386 uppP
Gene Locus tag Description
GSU0385 GSU0385 NAD-dependent nucleoside diphosphate-sugar epimerase/dehydratase
GSU0384 GSU0384 ferritin-like domain-containing protein
GSU0383 GSU0383 FKBP-type peptidylprolyl cis-trans isomerase
GSU0382 GSU0382 hypothetical protein
GSU0381 GSU0381 lipoprotein
lipA GSU0380 lipoyl synthase
lplA GSU0379 lipoate--protein ligase A
gcvP2 GSU0378 glycine dehydrogenase subunit 2
gcvP1 GSU0377 glycine dehydrogenase subunit 1
gcvH-1 GSU0376 glycine cleavage system lipoyl carrier protein GcvH
gcvT GSU0375 glycine cleavage system T protein
hypA GSU0374 hydrogenase nickel incorporation protein HypA
GSU0386 GSU0386 hypothetical protein
uppP GSU0387 undecaprenyl pyrophosphate phosphatase