Binding site | Location | Publication | Experimental techniques used | Curation |
---|---|---|---|---|
AGATTGTATACAGTATGCGATC | + [417289, 417310] | 19939938 |
|
457 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Gene | Locus tag | Description |
---|---|---|
GSU0385 | GSU0385 | NAD-dependent nucleoside diphosphate-sugar epimerase/dehydratase |
GSU0384 | GSU0384 | ferritin-like domain-containing protein |
GSU0383 | GSU0383 | FKBP-type peptidylprolyl cis-trans isomerase |
GSU0382 | GSU0382 | hypothetical protein |
GSU0381 | GSU0381 | lipoprotein |
lipA | GSU0380 | lipoyl synthase |
lplA | GSU0379 | lipoate--protein ligase A |
gcvP2 | GSU0378 | glycine dehydrogenase subunit 2 |
gcvP1 | GSU0377 | glycine dehydrogenase subunit 1 |
gcvH-1 | GSU0376 | glycine cleavage system lipoyl carrier protein GcvH |
gcvT | GSU0375 | glycine cleavage system T protein |
hypA | GSU0374 | hydrogenase nickel incorporation protein HypA |
GSU0386 | GSU0386 | hypothetical protein |
uppP | GSU0387 | undecaprenyl pyrophosphate phosphatase |