Binding site | Location | Publication | Experimental techniques used | Curation |
---|---|---|---|---|
ATAGTGCATACTGTATACACTT | - [544291, 544312] | 19939938 |
|
457 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Gene | Locus tag | Description |
---|---|---|
sfrB | GSU0510 | NADPH oxidoreductase subunit beta |
sfrA | GSU0509 | NADPH oxidoreductase subunit alpha |
yceG | GSU0508 | hypothetical protein |
plsY | GSU0507 | hypothetical protein |
GSU0506 | GSU0506 | hypothetical protein |
GSU0505 | GSU0505 | hypothetical protein |
GSU0504 | GSU0504 | hypothetical protein |
crcB | GSU0503 | camphor resistance protein CrcB |
GSU0502 | GSU0502 | lipoprotein |
yfiO | GSU0501 | outer membrane protein assembly lipoprotein YfiO |
typA | GSU0500 | translation-regulating membrane GTPase TypA |
GSU0511 | GSU0511 | leucyl aminopeptidase-like protein |
GSU0512 | GSU0512 | hypothetical protein |
GSU0513 | GSU0513 | dephospho-coenzyme A kinase |
GSU0514 | GSU0514 | IclR family transcriptional regulator |