Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000bbb0
Genome
Vibrio parahaemolyticus - NC_004603.1
TF
AphA [UniProtKB:Q87L53, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTATTCCACTTCATGCTTAT + [2929671, 2929690] 22984476 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - 506

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VP2762 VP2761 metF
Gene Locus tag Description
VP2762 VP2762 hypothetical protein
VP2761 VP2761 phosphoenolpyruvate carboxylase
metF VP2763 5,10-methylenetetrahydrofolate reductase