Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000bbc0
Genome
Vibrio parahaemolyticus - NC_004603.1
TF
AphA [UniProtKB:Q87L53, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATATGCACCATTACACTCAT + [2653117, 2653136] 22984476 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - 507

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VP2516 VP2515 VP2514 VP2517
Gene Locus tag Description
VP2516 VP2516 OpaR protein
VP2515 VP2515 hypoxanthine-guanine phosphoribosyltransferase
VP2514 VP2514 carbonic anhydrase
VP2517 VP2517 dihydrolipoamide dehydrogenase