Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000c7c0
Genome
Vibrio cholerae - NC_012668.1
TF
BreR [UniProtKB:Q9KR96, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATGTACACCCGAAAGTTTACTTT - [1776048, 1776071] 23144245 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 521

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_002628 VCD_002627 VCD_002629 VCD_002630 VCD_002631
Gene Locus tag Description
VCD_002628 VCD_002628 probable Co/Zn/Cd efflux system membrane fusion protein
VCD_002627 VCD_002627 transporter AcrB/D/F family
VCD_002629 VCD_002629 lipoprotein
VCD_002630 VCD_002630 paraquat-inducible protein B
VCD_002631 VCD_002631 paraquat-inducible protein A