Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cbc0
Genome
Bacillus amyloliquefaciens - NC_009725.1
TF
Zur [UniProtKB:P54479, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATCGTAATTATTACGTTTTA + [2351474, 2351495] 19648245 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Northern blot (ECO:0005653) - Experimental technique details RACE PCR (ECO:0005661) - 556

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rpmG yqjL yqjM RBAM_022110 RBAM_022100 rnz
Gene Locus tag Description
rpmG RBAM_022140 50S ribosomal protein L33
yqjL RBAM_022130 hypothetical protein
yqjM RBAM_022120 NADPH dehydrogenase NamA
RBAM_022110 RBAM_022110 hypothetical protein
RBAM_022100 RBAM_022100 LysR family transcriptional regulator
rnz RBAM_022150 ribonuclease Z