Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cbe0
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAAACGTGATCTAGATTGAACTT - [4278078, 4278100] 18710863 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 558

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rpoH ftsX ftsE ftsY YPO3815 rsmD yhhL
Gene Locus tag Description
rpoH YPO3811 RNA polymerase factor sigma-32
ftsX YPO3812 cell division protein FtsX
ftsE YPO3813 cell division protein FtsE
ftsY YPO3814 cell division protein
YPO3815 YPO3815 hypothetical protein
rsmD YPO3816 16S rRNA m(2)G966-methyltransferase
yhhL YPO3816a hypothetical protein