Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cc10
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGTATGTGACCTCCATCACCCAA + [2817311, 2817333] 18710863 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 558

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ompX YPO2507 YPO2508 tam
Gene Locus tag Description
ompX YPO2506 outer membrane protein X
YPO2507 YPO2507 threonine and homoserine efflux system
YPO2508 YPO2508 hypothetical protein
tam YPO2509 trans-aconitate 2-methyltransferase