Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cc20
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGGAAGTGATGGCGATCACAATA - [2711903, 2711925] 18710863 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 558

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... aroH YPO2410
Gene Locus tag Description
aroH YPO2411 phospho-2-dehydro-3-deoxyheptonate aldolase
YPO2410 YPO2410 hypothetical protein