Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cde0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Vfr [UniProtKB:P55222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATTGACTAATCGTTCACATTTG + [1187459, 1187482] 12218009 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 572

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... fleQ fleS fleR
Gene Locus tag Description
fleQ PA1097 transcriptional regulator FleQ
fleS PA1098 two-component sensor
fleR PA1099 two-component response regulator