Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cdf0
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAACAGTGAGTTATAGCACATAT - [1381896, 1381918] 21345179 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 573

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ompC micF
Gene Locus tag Description
ompC YPO1222 porin
micF YPOs05 ncRNA