Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000ce20
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Vfr [UniProtKB:P55222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACCGTCTGAAGCAGTTCTCAT - [2487483, 2487503] 18227247 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 575

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ptxR ptxS PA2260 PA2261 PA2262 PA2263
Gene Locus tag Description
ptxR PA2258 transcriptional regulator PtxR
ptxS PA2259 transcriptional regulator PtxS
PA2260 PA2260 hypothetical protein
PA2261 PA2261 2-ketogluconate kinase
PA2262 PA2262 2-ketogluconate transporter
PA2263 PA2263 2-hydroxyacid dehydrogenase