Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000ce90
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
LasR [UniProtKB:P25084, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACCTACCAGAACTGGTAGTT - [2934483, 2934502] 17449616 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 578

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA2591 PA2590 PA2589 PA2592
Gene Locus tag Description
PA2591 PA2591 transcriptional regulator
PA2590 PA2590 hypothetical protein
PA2589 PA2589 hypothetical protein
PA2592 PA2592 periplasmic spermidine/putrescine-binding protein