Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cfe0
Genome
Pseudomonas aeruginosa - NC_008463.1
TF
OxyR [UniProtKB:Q9HTL4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAATTTATTAAAGACAGCGAGACGATAGATAAAAACTTTA - [772883, 772922] 19933365 Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - 590

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... katA bfrA
Gene Locus tag Description
katA PA14_09150 catalase
bfrA PA14_09160 bacterioferritin