Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000d0a0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Vfr [UniProtKB:P55222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGCAAATGGCTAGGTCACAGAA + [5680790, 5680811] 17159200 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 594

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pilM pilN pilO pilP pilQ aroK aroB PA5037 ponA
Gene Locus tag Description
pilM PA5044 type 4 fimbrial biogenesis protein PilM
pilN PA5043 type 4 fimbrial biogenesis protein PilN
pilO PA5042 type 4 fimbrial biogenesis protein PilO
pilP PA5041 type 4 fimbrial biogenesis protein PilP
pilQ PA5040 type 4 fimbrial biogenesis outer membrane protein PilQ precursor
aroK PA5039 shikimate kinase
aroB PA5038 3-dehydroquinate synthase
PA5037 PA5037 hypothetical protein
ponA PA5045 penicillin-binding protein 1A