Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000d0b0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Vfr [UniProtKB:P55222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATGTGATTTAAAACACATGA - [921706, 921727] 17159200 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 594

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... plcH plcR PA0842
Gene Locus tag Description
plcH PA0844 hemolytic phospholipase C
plcR PA0843 phospholipase accessory protein PlcR
PA0842 PA0842 glycosyl transferase family protein