Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000d0c0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Vfr [UniProtKB:P55222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATTGTGATGAAGTTGGCATGA - [3722909, 3722930] 17159200 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 594

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... plcN
Gene Locus tag Description
plcN PA3319 non-hemolytic phospholipase C