Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000f120
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
OxyR [UniProtKB:Q9HTL4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATAGGCTGACTCTATCGTGCGAATTGAAATTCGACAT + [927016, 927052] 10913087 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - 617

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA0848 PA0847 PA0846 trxB2
Gene Locus tag Description
PA0848 PA0848 alkyl hydroperoxide reductase
PA0847 PA0847 hypothetical protein
PA0846 PA0846 sulfate transporter CysZ
trxB2 PA0849 thioredoxin reductase