Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000f130
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
OxyR [UniProtKB:Q9HTL4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATAGATTTAGATAATTTCACTGATGGCCTAAATCAAT + [158084, 158120] 10913087 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - 617

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ahpC ahpF
Gene Locus tag Description
ahpC PA0139 alkyl hydroperoxide reductase
ahpF PA0140 alkyl hydroperoxide reductase