Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00012f00
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
LasR [UniProtKB:P25084, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CACTGCCAGATCTGGCAGTT + [2031377, 2031396] 11544214 Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 653

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA1869
Gene Locus tag Description
PA1869 PA1869 acyl carrier protein