Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00012f10
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
LasR [UniProtKB:P25084, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACCTACCAGATCTTGTAGTT + [4713406, 4713425] 11544214 Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 653

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... phzA1 phzM phzB1 phzC1 phzD1 phzE1 phzF1 phzG1
Gene Locus tag Description
phzA1 PA4210 phenazine biosynthesis protein
phzM PA4209 phenazine-specific methyltransferase
phzB1 PA4211 phenazine biosynthesis protein
phzC1 PA4212 phenazine biosynthesis protein PhzC
phzD1 PA4213 phenazine biosynthesis protein PhzD
phzE1 PA4214 phenazine biosynthesis protein PhzE
phzF1 PA4215 phenazine biosynthesis protein
phzG1 PA4216 pyridoxamine 5'-phosphate oxidase