Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00014940
Genome
Vibrio parahaemolyticus - NC_004603.1
TF
LexA [UniProtKB:Q87KN2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACCTGTATAAATAAACAGAC + [1948251, 1948270] 21529368 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 664

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VP1865
Gene Locus tag Description
VP1865 VP1865 site-specific recombinase IntIA