Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00014960
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Vfr [UniProtKB:P55222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GAAACAAGAGCTAGCTCACAC + [5282991, 5283011] 19801409 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 666

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... cbpA PA4703 prrF1 prrF2
Gene Locus tag Description
cbpA PA4704 cAMP-binding protein A
PA4703 PA4703 hypothetical protein
prrF1 PA4704.1 ncRNA
prrF2 PA4704.2 ncRNA