Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00014cb0
Genome
Shewanella oneidensis - NC_004347.2
TF
Fur [UniProtKB:Q8EFN3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAATGAGATTTGTTCTTATTT - [1863944, 1863964] 15576789 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 689

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... omcA
Gene Locus tag Description
omcA SO_1779 extracelllular iron oxide respiratory system surface decaheme cytochrome c component OmcA