Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00014cd0
Genome
Neisseria meningitidis - NC_003112.2
TF
Fur [UniProtKB:P0A0S8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGTATTATAACGTCTATTGTTTTACA + [205779, 205804] 14526014 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details S1 nuclease protection (ECO:0005666) - Experimental technique details Visual sequence inspection (nan) - 690

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... fur NMB0204 dapB aat
Gene Locus tag Description
fur NMB0205 ferric uptake regulation protein
NMB0204 NMB0204 lipoprotein
dapB NMB0203 dihydrodipicolinate reductase
aat NMB0206 leucyl/phenylalanyl-tRNA--protein transferase