Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021630
Genome
Helicobacter pylori - NC_011333.1
TF
Fur [UniProtKB:B5Z6G7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAC + [1111302, 1111344] 19399190 Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNAse protection (ECO:0000288) - Experimental technique details Visual sequence inspection (nan) - 700

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HPG27_1008 HPG27_1007 HPG27_1009
Gene Locus tag Description
HPG27_1008 HPG27_1008 iron-dependent superoxide dismutase
HPG27_1007 HPG27_1007 adhesin-thiol peroxidase
HPG27_1009 HPG27_1009 hypothetical protein