Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021790
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
PhzR [UniProtKB:G3XD77, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACCTGCCCGGAAGGGCAGGTTGTCCC - [2068990, 2069015] 16390453 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 717

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA1897 PA1896 PA1895 PA1894 PA1893 PA1892 PA1891 PA1890 qscR
Gene Locus tag Description
PA1897 PA1897 hypothetical protein
PA1896 PA1896 hypothetical protein
PA1895 PA1895 hypothetical protein
PA1894 PA1894 hypothetical protein
PA1893 PA1893 hypothetical protein
PA1892 PA1892 hypothetical protein
PA1891 PA1891 hypothetical protein
PA1890 PA1890 glutathione S-transferase
qscR PA1898 quorum-sensing control repressor