Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000217a0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
PchR [UniProtKB:P40883, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA + [4742303, 4742334] 16194235 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 718

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pchD pchA pchB pchC pchR
Gene Locus tag Description
pchD PA4228 pyochelin biosynthesis protein PchD
pchA PA4231 salicylate biosynthesis isochorismate synthase
pchB PA4230 isochorismate-pyruvate lyase
pchC PA4229 pyochelin biosynthetic protein PchC
pchR PA4227 transcriptional regulator PchR