Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021940
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Fur [UniProtKB:P0A9A9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAATAATCAATCTCATTATC - [5000321, 5000340] 8806672 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - 733

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... 5000000 PA4471 fumC1 PA4469 sodM PA4467
Gene Locus tag Description
PA4471 PA4471 hypothetical protein
fumC1 PA4470 fumarate hydratase
PA4469 PA4469 hypothetical protein
sodM PA4468 superoxide dismutase
PA4467 PA4467 hypothetical protein