Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021da0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGCACCTACGCAGATGCGACATGCGTCATGCAATTTTGCGACA - [1045459, 1045501] 10464217 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details RNA dot blot (ECO:0001177) - 768

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... oprD PA0959 PA0960
Gene Locus tag Description
oprD PA0958 porin
PA0959 PA0959 hypothetical protein
PA0960 PA0960 hypothetical protein