Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021de0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGGCTTGCCCTTGTAAGAAAAGGTCGCGGCAACACAAGTCGG - [1974699, 1974740] 15175299 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 769

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ldcA PA1819 PA1817
Gene Locus tag Description
ldcA PA1818 lysine-specific pyridoxal 5'-phosphate-dependent carboxylase, LdcA
PA1819 PA1819 amino acid permease
PA1817 PA1817 hypothetical protein