Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00022000
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Vfr [UniProtKB:P55222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGTACGGGATCACAGTCCTGATAGCTGCGTCG - [706860, 706891] 20494996 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details In-vitro transcription (ECO:0001204) - 784

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... vfr PA0653
Gene Locus tag Description
vfr PA0652 cAMP-regulatory protein
PA0653 PA0653 hypothetical protein