Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00022020
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
PyeR [UniProtKB:Q9HW47, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATATCGTCCCACACCGATATATAGTTCGTCCCAACCCGAT + [4881989, 4882028] 22820840 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 786

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA4354 PA4355 xenB PA4353 PA4352
Gene Locus tag Description
PA4354 PA4354 hypothetical protein
PA4355 PA4355 major facilitator superfamily (MFS) transporter
xenB PA4356 xenobiotic reductase
PA4353 PA4353 hypothetical protein
PA4352 PA4352 hypothetical protein