Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00022250
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
PvdS [UniProtKB:G3XCV1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAAATTTCATTTCCCTGTCCTCGT - [2640342, 2640365] 12207696 Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA-array expression analysis (ECO:0005525) - 801

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pvdA pvdQ
Gene Locus tag Description
pvdA PA2386 L-ornithine N5-oxygenase
pvdQ PA2385 3-oxo-C12-homoserine lactone acylase PvdQ