Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00022540
Genome
Yersinia pestis - NC_005810.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGCAAGGTGTTAGATTGATCACGTTTCCAGCA + [3570247, 3570278] 23647342 Experimental technique details Ad-hoc quantitative phenotype observation (ECO:0005676) - Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - 820

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... cyaA YP_3198 hemC hemD hemX hemY2
Gene Locus tag Description
cyaA YP_3199 adenylate cyclase
YP_3198 YP_3198 hypothetical protein
hemC YP_3197 porphobilinogen deaminase
hemD YP_3196 uroporphyrinogen-III synthase
hemX YP_3195 uroporphyrinogen III C-methyltransferase
hemY2 YP_3194 protoheme IX biogenesis protein