Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00022570
Genome
Corynebacterium glutamicum - NC_003450.3
TF
GlxR [UniProtKB:Q79VI7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGTGACAGAGTCAACTCTCGG + [3227781, 3227801] 24795375 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 821

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... NCgl2922 NCgl2921 NCgl2923
Gene Locus tag Description
NCgl2922 NCgl2922 benzoate transporter
NCgl2921 NCgl2921 hypothetical protein
NCgl2923 NCgl2923 hydroxylase/monooxygenase