Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000230c0
Genome
Bordetella petrii - NC_010170.1
TF
ClcR [UniProtKB:A0A024HKB0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAGCCATACCGATCCCGTATTGCAAAGGCTAAAAAAAGGTATTGGACC + [1581754, 1581801] 9171413 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - 833

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... clcA clcR catB2 bug36 Bpet1537 Bpet1538 Bpet1539
Gene Locus tag Description
clcA Bpet1534 catechol 1,2-dioxygenase
clcR Bpet1533 transcriptional regulator clcR
catB2 Bpet1535 muconate cycloisomerase I
bug36 Bpet1536 hypothetical protein
Bpet1537 Bpet1537 carboxymethylenebutenolidase
Bpet1538 Bpet1538 maleylacetate reductase
Bpet1539 Bpet1539 AraC family transcriptional regulator