Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00024680
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATGTTAATGCATTTTTAACTA - [297185, 297205] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... intF yagN ptwF
Gene Locus tag Description
intF b0281 CP4-6 prophage; predicted phage integrase
yagN b0280 CP4-6 prophage; predicted protein
ptwF b4629 tRNA