Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00024740
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTGTTACCTAAACGTAACAAT - [1397317, 1397337] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ynaJ
Gene Locus tag Description
ynaJ b1332 predicted inner membrane protein, DUF2534 family