Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00024770
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTGTTATGGAAGTGTTAAGGT - [1682037, 1682057] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rstA ydgC rstB tus
Gene Locus tag Description
rstA b1608 multicopy supressor of yjeE, yeaZ or ygjD deletion lethality, predicted response regulator of two-component regulatory system with sensor protein RstB
ydgC b1607 inner membrane protein, GlpM family
rstB b1609 sensory histidine kinase in two-component regulatory system with RstA
tus b1610 inhibitor of replication at Ter, DNA-binding protein