Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000250d0
Genome
Vibrio campbellii - NC_009784.1
TF
LuxR [UniProtKB:A7MXJ7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCTGATAAATGTATTAGTAG - [1833630, 1833650] 23204455 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 889

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VIBHAR_06697 VIBHAR_06698
Gene Locus tag Description
VIBHAR_06697 VIBHAR_06697 miscRNA
VIBHAR_06698 VIBHAR_06698 hypothetical protein