Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00025190
Genome
Vibrio campbellii - NC_009783.1
TF
LuxR [UniProtKB:A7MXJ7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TATTGAGTTCACAATCAATAC - [178957, 178977] 18681939 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Fluorescence anisotropy (ECO:0005632) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 894

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VIBHAR_00176 fis VIBHAR_00177 VIBHAR_00178
Gene Locus tag Description
VIBHAR_00176 VIBHAR_00176 diguanylate cyclase
fis VIBHAR_00175 DNA-binding protein Fis
VIBHAR_00177 VIBHAR_00177 transposase
VIBHAR_00178 VIBHAR_00178 transposase