Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00025340
Genome
Aliivibrio fischeri - NC_011186.1
TF
LuxR [UniProtKB:B5EV73, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GAATGGATCATTTTGCAGGT - [1160139, 1160158] 1560004 Experimental technique details Ad-hoc quantitative phenotype observation (ECO:0005676) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 907

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... luxD VFMJ11_A1039 VFMJ11_A1038 VFMJ11_A1037 fre
Gene Locus tag Description
luxD VFMJ11_A1040 acyl transferase
VFMJ11_A1039 VFMJ11_A1039 alkanal monooxygenase alpha chain
VFMJ11_A1038 VFMJ11_A1038 alkanal monooxygenase beta chain
VFMJ11_A1037 VFMJ11_A1037 long-chain-fatty-acid--luciferin-component ligase (Acyl-protein synthetase)
fre VFMJ11_A1036 FMN reductase