Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029590
Genome
Streptomyces coelicolor - NC_003888.3
TF
BldD [UniProtKB:Q7AKQ8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGTGCCTGCACGAAGCGTTATTCTCC + [3675068, 3675093] 11298292 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Northern blot (ECO:0005653) - Experimental technique details S1 nuclease protection (ECO:0005666) - 920

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SCO3323
Gene Locus tag Description
SCO3323 SCO3323 RNA polymerase sigma factor