Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029640
Genome
Vibrio cholerae - NC_012668.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAATTGACTCAAAAATAAACAA - [2593015, 2593036] 19276207 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details PSSM site search (ECO:0005659) - 924

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_003338 VCD_003337 VCD_003336 VCD_003335 VCD_003334
Gene Locus tag Description
VCD_003338 VCD_003338 acetyl-CoA carboxylase subunit beta
VCD_003337 VCD_003337 dihydrofolate synthase/folylpolyglutamate synthase
VCD_003336 VCD_003336 DedD protein
VCD_003335 VCD_003335 bacteriocin production protein
VCD_003334 VCD_003334 amidophosphoribosyltransferase