Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029650
Genome
Vibrio cholerae - NC_012668.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTATTTATTGAGAAAATAGGTC + [789014, 789035] 19276207 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details PSSM site search (ECO:0005659) - 924

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_001729 VCD_001730 VCD_001728 VCD_001731 VCD_001732 VCD_001733
Gene Locus tag Description
VCD_001729 VCD_001729 type IV pilus biogenesis protein PilM
VCD_001730 VCD_001730 type IV pilus biogenesis protein PilN
VCD_001728 VCD_001728 multimodular transpeptidase-transglycosylase
VCD_001731 VCD_001731 type IV pilus biogenesis protein PilO
VCD_001732 VCD_001732 type IV pilus biogenesis protein PilP
VCD_001733 VCD_001733 type IV pilus biogenesis protein PilQ