Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029680
Genome
Vibrio cholerae - NC_012668.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTATTTAGCCGCCAATAATAAT + [474596, 474617] 19276207 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details PSSM site search (ECO:0005659) - 924

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_001442 VCD_001443 VCD_001444 VCD_001445 VCD_001446
Gene Locus tag Description
VCD_001442 VCD_001442 ATP-dependent DNA helicase Rep
VCD_001443 VCD_001443 TetR family transcriptional regulator
VCD_001444 VCD_001444 probable RND efflux membrane fusion protein
VCD_001445 VCD_001445 RND multidrug efflux transporter
VCD_001446 VCD_001446 hypothetical protein